Archives

  • 2026-04
  • 2026-03
  • 2026-02
  • 2026-01
  • 2025-12
  • 2025-11
  • 2025-10

    • Influenza Hemagglutinin (HA) Peptide: Precision Tag for A...

    2025-12-20

    Influenza Hemagglutinin (HA) Peptide: Precision Tag for Advanced Protein Purification

    Introduction: The Principle of the Influenza Hemagglutinin (HA) Peptide Tag

    The Influenza Hemagglutinin (HA) Peptide (HA tag peptide) has become a cornerstone in molecular biology, enabling streamlined detection, purification, and analysis of recombinant proteins. Derived from the epitope region of the human influenza hemagglutinin protein (sequence: YPYDVPDYA), this nine-amino acid epitope tag facilitates highly specific and reversible interactions with anti-HA antibodies, making it ideal for both qualitative and quantitative protein studies. As a synthetic peptide supplied at >98% purity (validated by HPLC and MS) and exhibiting high solubility (≥55.1 mg/mL in DMSO, ≥100.4 mg/mL in ethanol, ≥46.2 mg/mL in water), the HA tag peptide provides unmatched flexibility for diverse buffer systems and experimental workflows.

    When fused to a protein of interest, the Influenza Hemagglutinin (HA) Peptide serves as a molecular handle—enabling robust detection, efficient immunoprecipitation with Anti-HA antibody reagents (e.g., magnetic beads or agarose), and gentle, competitive elution. This strategy is especially valuable in protein-protein interaction studies, where preservation of native complexes and reproducibility are paramount. The HA tag’s short sequence minimizes interference with protein structure or function, distinguishing it from bulkier affinity tags.

    Step-by-Step Workflow: Optimizing Immunoprecipitation and Elution with HA Tag Peptide

    1. Construct Design and Expression

    • Fusion Strategy: Incorporate the HA tag sequence (tacccctacgacgtgcccgactacgccc; refer to ha tag nucleotide sequence or ha tag DNA sequence for cloning) at the N- or C-terminus of the target protein using PCR or synthetic gene assembly.
    • Expression: Express the HA-tagged protein in the host system (mammalian, yeast, or bacterial), optimizing for solubility and yield.

    2. Protein Capture: Immunoprecipitation with Anti-HA Antibody

    • Cell Lysis: Lyse cells under non-denaturing conditions to preserve protein-protein interactions.
    • Binding: Incubate lysate with Anti-HA Magnetic Beads or agarose-conjugated Anti-HA antibody, allowing selective capture of HA fusion proteins via specific, high-affinity binding to the influenza hemagglutinin epitope.
    • Washing: Perform stringent washes to remove non-specifically bound proteins without disrupting genuine interactions.

    3. Competitive Elution Using HA Peptide

    • Elution Principle: Introduce synthetic HA peptide (typically 1–2 mg/mL, depending on resin capacity) to outcompete the HA-tagged protein for binding to the antibody, gently releasing the native complex into solution.
    • Advantages: This competitive binding to Anti-HA antibody preserves multi-protein complexes and post-translational modifications, outperforming harsh elution methods.
    • Elution Optimization: Titrate peptide concentration and incubation time for maximal recovery—yields of >95% are routinely achieved with the high-purity APExBIO HA peptide.

    4. Downstream Analysis

    • Analyze eluates by SDS-PAGE, Western blotting (using a secondary anti-HA antibody to confirm specificity), mass spectrometry, or functional assays.
    • Quantify protein recovery and purity using densitometry or label-free MS, leveraging the minimal background provided by the HA tag system.

    Advanced Applications and Comparative Advantages

    Protein-Protein Interaction Mapping and Exosome Biology

    In protein-protein interaction studies, the HA tag’s small size and high specificity are leveraged for co-immunoprecipitation (co-IP), affinity purification, and interaction screening. The competitive elution enabled by the HA peptide minimizes disruption of native complexes, facilitating detailed mechanistic insights. For instance, recent research on exosome biogenesis (Wei et al., Cell Research, 2021) utilized HA-tagged constructs to dissect ESCRT-independent pathways—demonstrating how the HA tag enables precise capture and analysis of vesicle-associated proteins, such as those involved in RAB31-mediated exosome secretion. The ability to recover intact complexes is critical for elucidating the regulatory machinery of exosome formation and secretion, as well as for profiling interacting partners in cancer or neurodegenerative disease models.

    Comparative Benchmarking and Literature Extensions

    Compared to alternative tags (e.g., FLAG, Myc), the hemagglutinin tag offers a balance of minimal size, high affinity, and elution flexibility. The HA tag sequence’s compatibility with a wide range of vectors and its validated performance in both standard and advanced workflows reinforce its status as a preferred molecular biology peptide tag.

    Troubleshooting and Optimization Tips

    Common Pitfalls and Solutions

    • Low Protein Recovery: Ensure the HA peptide is at sufficient concentration for effective competitive binding. For highly abundant targets, increase the peptide concentration and extend incubation.
    • Non-Specific Binding: Include additional wash steps or use more stringent buffers (e.g., higher salt or detergent concentrations) to minimize carryover of interacting proteins that do not bind via the HA tag.
    • Peptide Solubility Issues: Dissolve the peptide in DMSO, ethanol, or water based on downstream application. The APExBIO peptide’s high solubility (≥100.4 mg/mL in ethanol) enables preparation of concentrated stocks for efficient use.
    • Tag Accessibility: If the HA tag is buried within the fusion protein, consider repositioning the tag (N- vs. C-terminal) or introducing flexible linkers to improve antibody access.
    • Long-term Storage: Store lyophilized peptide desiccated at -20°C. Avoid repeated freeze-thaw cycles; prepare fresh working solutions before use for maximum activity.

    Experimental Enhancements

    • For challenging co-IP studies, pre-clear lysates with control beads to minimize background before incubation with Anti-HA antibody.
    • To assess efficiency, spike in a known quantity of HA-tagged standard and compare recovery across conditions.
    • In applications demanding ultra-low background (e.g., mass spectrometry), use affinity-purified anti-HA antibody and high-purity HA peptide to reduce contaminant signals.

    Future Outlook: Expanding the Utility of the HA Tag

    The utility of the HA tag and its peptide extends beyond traditional protein purification. In emerging areas such as extracellular vesicle (EV) and exosome research, as exemplified by the Cell Research study, the ability to capture and analyze low-abundance, membrane-bound signaling complexes is transforming our understanding of intercellular communication and disease mechanisms. The robust performance of the HA peptide supports high-throughput screening, quantitative interactomics, and translational workflows in cancer, immunology, and neurobiology.

    Moreover, as synthetic biology and genome engineering advance, the HA tag’s compatibility with multiplex tagging and dual-affinity strategies will enable more intricate dissection of multi-component pathways and post-translational regulatory events. Innovations in antibody engineering and tag design may further enhance sensitivity and specificity, but the core value of the influenza hemagglutinin epitope as a universally recognized, minimally disruptive tag remains unchallenged.

    For researchers seeking reliability, scalability, and broad experimental compatibility, the Influenza Hemagglutinin (HA) Peptide from APExBIO offers a validated, high-purity solution trusted across the molecular biology community.